Journal: Frontiers in Immunology

Article Title: Extracellular miR-574-5p Induces Osteoclast Differentiation via TLR 7/8 in Rheumatoid Arthritis

doi: 10.3389/fimmu.2020.585282

Figure Lengend Snippet: Increased OC differentiation by sEV-delivered miR-574-5p is mediated by TLR7/8 activation (A) Comparison of sequence homologies of miR-574-5p and miR-16-5p to RNA33. (B,C) In microscale thermophoresis (MST) affinity assay of miR-574-5p to human recombinant TLR8, 50 nM of Cy5-labeled miR-574-5p and 334 nM−10.2 pM of non-labeled TLR8 were used. As negative control, 50 nM of Cy5-labeled hsa-miR-16-5p with 209 nM−6.36 pM of TLR8 were used. After a short incubation, samples were loaded into Monolith NT.115 Standard Treated Capillaries and the MST measurement was performed (B) Dose response curve reveals a K D of 30.8 ± 5.24 nM for the interaction of miR-574-5p and TLR8. Data are shown as ± SD ( N = 3). (C) MST traces shown for miR-574-5p or miR-16-5p and TLR8. An MST-on time of 1.5 s was used for analysis. (D–G) TRAP-positive OCs obtained from CD14 + monocytes cultured in presence of (D,E) 1 μg/ml ScrC- or miR-574-5p oe sEV together with 200 nM TLR7/8 inhibitor ODN 2087 or (F,G) 10–1,000 ng/ml - TLR7/8 ligand R848 added either at (D/F) monocyte stage or (E/G) M2-like macrophage stage. TRAP-positive cells with three or more nuclei were considered as OCs. The relative changes normalized to untreated control cells are given as mean + SEM ( N = 4), one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Cells were additionally treated with 200 nM of the TLR7/8 inhibitor ODN 2088 Control (2087) (MiltenyiBiotec, Bergisch-Gladbach, GER), diluted in TE buffer, 30 min prior to stimulation with EV or R848 at indicated experiments.

Techniques: Activation Assay, Comparison, Sequencing, Microscale Thermophoresis, Recombinant, Labeling, Negative Control, Incubation, Cell Culture, Control

Journal: Frontiers in Immunology

Article Title: Extracellular miR-574-5p Induces Osteoclast Differentiation via TLR 7/8 in Rheumatoid Arthritis

doi: 10.3389/fimmu.2020.585282

Figure Lengend Snippet: Effect of sEV-delivered miR-574-5p on IL-23 and IFNα mRNA levels. CD-14+ monocytes were stimulated with (A,B) 4 μg/ml sEV isolated from synovial fluid of ACPA+ RA patients or (C,D) 1 μg/ml of ScrC or miR-574-5p oe sEV and 200 nM ODN 2087. Cells were harvested after 4 h of incubation and total RNA was extracted. Quantification of (A,C) IL-23 and (B,D) IFNα mRNA levels using RT-qPCR. (E,F) CD14+ monocytes were stimulated with 10 ng/μl R848 and 200 nM of ODN 2087 for 4 h. Total RNA was extracted, and RT-qPCR was performed to quantify (E) IL-23 and (F) IFNα mRNA level. β-Actin was used as endogenous control. Relative changes normalized to untreated controls are given as + SEM ( N = 4), one-way ANOVA, * p < 0.05.

Article Snippet: Cells were additionally treated with 200 nM of the TLR7/8 inhibitor ODN 2088 Control (2087) (MiltenyiBiotec, Bergisch-Gladbach, GER), diluted in TE buffer, 30 min prior to stimulation with EV or R848 at indicated experiments.

Techniques: Isolation, Incubation, Quantitative RT-PCR, Control

Journal:

Article Title: Btk regulates localization, in vivo activation, and class switching of anti-DNA B cells

doi: 10.1016/j.molimm.2008.08.278

Figure Lengend Snippet: A) Total splenocytes were stained on ice with FITC-labeled donkey anti-mouse Ig F(ab)’2 fragments. Cells were then incubated at 37°C for the indicated times to induce BCR signaling and internalization and analyzed by flow cytometry. The mean fluorescence intensity of FITC+ cells was determined and is presented as % of the starting value. Internalization of the BCR is accompanied by a reduction in fluorescence due to entry of the FITC label into acidic compartments (Aluvihare et al, 1997). Data represent the mean +/− SD for two experiments. Similar results were also obtained with xid mice, which have an inactivating point mutation in Btk (data not shown). B, C) Purified B cells were stimulated with media alone, 20 ug/ml anti-IgM F(ab)’2 fragments, 0.1 ug/ml CG50 fragment +/− 4 ug/ml inhibitory ODN 2088, or 0.1 ug/ml HIV (CG+) fragment. Proliferation was measured by 3H-thymidine incorporation during the final 12 hrs of a 36 hr culture. Cpm are presented as mean +/− SEM, n = 3–6. * = p < 0.05, ** = p < 0.01 56R vs. no 56R. D) Stimulation index = avg cpm stimulated/avg cpm media from the data in B and C. Note that the response of wt cells to anti-IgM is off scale in B and D. The legend in panel C is also for panels B and D.

Article Snippet: Phosphorothiorate-modified stimulatory oligodeoxynucleotide (ODN) 1826 5’ TCCATGACGTTCCTGACGTT 3’ ( Yi et al ., 1998 ) and inhibitory ODN 2088 5’ TCCTGGCGGGGAAGT 3’ ( Lenert et al ., 2001 ) were obtained from Oligo’s Etc.

Techniques: Staining, Labeling, Incubation, Flow Cytometry, Fluorescence, Mutagenesis, Purification